Skip to main content

pPN234
(Plasmid #91591)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91591 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19-U6 promoter
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CYFIP1
  • Alt name
    NM_014608.3
  • gRNA/shRNA sequence
    GCTGCTCGTTACATTTCACC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    21
  • Entrez Gene
    CYFIP1 (a.k.a. P140SRA-1, SHYC, SRA-1, SRA1)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer M13F (-21)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains an additional 21 bp in the scaffold region, of which 18 bp directly matches the CYFIP1 target sequence, indicating that pPN234 contains a dimeric target sequence that will express a longer, dimeric sgRNA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPN234 was a gift from Lindy Barrett (Addgene plasmid # 91591 ; http://n2t.net/addgene:91591 ; RRID:Addgene_91591)
  • For your References section:

    A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Hazelbaker DZ, Beccard A, Bara AM, Dabkowski N, Messana A, Mazzucato P, Lam D, Manning D, Eggan K, Barrett LE. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006. 10.1016/j.stemcr.2017.09.006 PubMed 29020615