MKbpAII
(Plasmid
#91689)
-
PurposeMMTV-LTR promoter/enhancer with rabbit beta-globin intron and bovine growth hormone poly-A sequence to enhance transgene expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescriptII
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 6224
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMMTV LTR cloned into KbpA vector
-
SpeciesM. musculus (mouse), B. taurus (bovine); rabbit
-
Insert Size (bp)3300
- Promoter MMTV LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer GTTGTAAAACGACGGCCAGT
- 3′ sequencing primer ATGAGACAGCACAATAACCAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MKbpAII was a gift from Jeffrey Rosen (Addgene plasmid # 91689 ; http://n2t.net/addgene:91689 ; RRID:Addgene_91689) -
For your References section:
A beta-catenin survival signal is required for normal lobular development in the mammary gland. Tepera SB, McCrea PD, Rosen JM. J Cell Sci. 2003 Mar 15;116(Pt 6):1137-49. PubMed 12584256