Skip to main content

MKbpAII
(Plasmid #91689)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91689 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescriptII
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 6224
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MMTV LTR cloned into KbpA vector
  • Species
    M. musculus (mouse), B. taurus (bovine); rabbit
  • Insert Size (bp)
    3300
  • Promoter MMTV LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer GTTGTAAAACGACGGCCAGT
  • 3′ sequencing primer ATGAGACAGCACAATAACCAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MKbpAII was a gift from Jeffrey Rosen (Addgene plasmid # 91689 ; http://n2t.net/addgene:91689 ; RRID:Addgene_91689)
  • For your References section:

    A beta-catenin survival signal is required for normal lobular development in the mammary gland. Tepera SB, McCrea PD, Rosen JM. J Cell Sci. 2003 Mar 15;116(Pt 6):1137-49. PubMed 12584256