-
Purpose(Empty Backbone) Lentiviral/gateway cloning vector for C-terminally tagging proteins of interest with the dTAG system
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91798 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLEX_305
-
Backbone manufacturerDavid Root Lab (addgene #41390)
- Backbone size (bp) 9621
-
Modifications to backboneFKBP F36V tag (dTAG) added to the 3' end of the gateway cassette.
-
Vector typeMammalian Expression, Lentiviral
- Promoter hPGK
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- FKBP F36V (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsccdB resistant bacteria. 30C for liquid culture and for plates.
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TGTTCCGCATTCTGCAAGCCTC
- 3′ sequencing primer ACAAAGGCATTAAAGCAGCGTATCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX_305-C-dTAG was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91798 ; http://n2t.net/addgene:91798 ; RRID:Addgene_91798) -
For your References section:
The dTAG system for immediate and target-specific protein degradation. Nabet B, Roberts JM, Buckley DL, Paulk J, Dastjerdi S, Yang A, Leggett AL, Erb MA, Lawlor MA, Souza A, Scott TG, Vittori S, Perry JA, Qi J, Winter GE, Wong KK, Gray NS, Bradner JE. Nat Chem Biol. 2018 May;14(5):431-441. doi: 10.1038/s41589-018-0021-8. Epub 2018 Mar 26. 10.1038/s41589-018-0021-8 PubMed 29581585