Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pDD121
(Plasmid #91833)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 91833 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCFJ601
  • Backbone manufacturer
    Erik Jorgensen lab (Addgene #24874)
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    Synthetic
  • Insert Size (bp)
    4323
  • Mutation
    Codon optimized and with synthetic introns for C. elegans

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAGTTGGGAAACACTTTGCT
  • 3′ sequencing primer gcttgaaaggattttgcatttatc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Same Cas9 expression cassette present in the widely-used pDD162, but does not have an sgRNA expression cassette.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDD121 was a gift from Bob Goldstein (Addgene plasmid # 91833 ; http://n2t.net/addgene:91833 ; RRID:Addgene_91833)
  • For your References section:

    SapTrap assembly of repair templates for Cas9-triggered homologous recombination with a self-excising cassette. Dickinson D, Slabodnick M, Chen A, Goldstein B. MicroPubl Biol. 2018 May 1;2018:10.17912/W2KT0N. doi: 10.17912/W2KT0N. 10.17912/W2KT0N PubMed 32550377