pDD379
(Plasmid
#91834)
-
Purpose(Empty Backbone) SapTrap destination vector for building combined sgRNA expression + repair template vectors, using the F+E sgRNA scaffold
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91834 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMLS256
-
Backbone manufacturerErik Jorgensen lab (Addgene #73715)
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pMLS256 was modified by replacing the sgRNA scaffod with the "F+E" sgRNA and the sgRNA promoter with the one from pDD162.The sgRNA can be sequenced with primer ggtgtgaaataccgcacaga (same primer as used for pDD162).
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDD379 was a gift from Bob Goldstein (Addgene plasmid # 91834 ; http://n2t.net/addgene:91834 ; RRID:Addgene_91834) -
For your References section:
SapTrap assembly of repair templates for Cas9-triggered homologous recombination with a self-excising cassette. Dickinson D, Slabodnick M, Chen A, Goldstein B. MicroPubl Biol. 2018 May 1;2018:10.17912/W2KT0N. doi: 10.17912/W2KT0N. 10.17912/W2KT0N PubMed 32550377
Included in kit:
Related items:
