pDD379
(Plasmid
#91834)
-
Purpose(Empty Backbone) SapTrap destination vector for building combined sgRNA expression + repair template vectors, using the F+E sgRNA scaffold
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 91834 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMLS256
-
Backbone manufacturerErik Jorgensen lab (Addgene #73715)
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
Depositor Comments
pMLS256 was modified by replacing the sgRNA scaffod with the "F+E" sgRNA and the sgRNA promoter with the one from pDD162.The sgRNA can be sequenced with primer ggtgtgaaataccgcacaga (same primer as used for pDD162).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDD379 was a gift from Bob Goldstein (Addgene plasmid # 91834 ; http://n2t.net/addgene:91834 ; RRID:Addgene_91834)