pDD379
(Plasmid #91834)

• Purpose: (Empty Backbone) SapTrap destination vector for building combined sgRNA expression + repair template vectors, using the F+E sgRNA scaffold
• Depositing Lab: Bob Goldstein
• Publication: Unpublished SapTrap/SEC plasmids (unpublished)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	91834	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pMLS256
  (Search Vector Database)
• Backbone manufacturer: Erik Jorgensen lab (Addgene #73715)
• Vector type: Worm Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: None

Resource Information

• Supplemental Documents:
  • SapTrap Dest sgRNA F+E pDD379.ape
• Terms and Licenses:
  • UBMTA

Depositor Comments

pMLS256 was modified by replacing the sgRNA scaffod with the "F+E" sgRNA and the sgRNA promoter with the one from pDD162.The sgRNA can be sequenced with primer ggtgtgaaataccgcacaga (same primer as used for pDD162).