Skip to main content

pDD379
(Plasmid #91834)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91834 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMLS256
  • Backbone manufacturer
    Erik Jorgensen lab (Addgene #73715)
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pMLS256 was modified by replacing the sgRNA scaffod with the "F+E" sgRNA and the sgRNA promoter with the one from pDD162.The sgRNA can be sequenced with primer ggtgtgaaataccgcacaga (same primer as used for pDD162).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDD379 was a gift from Bob Goldstein (Addgene plasmid # 91834 ; http://n2t.net/addgene:91834 ; RRID:Addgene_91834)
  • For your References section:

    SapTrap assembly of repair templates for Cas9-triggered homologous recombination with a self-excising cassette. Dickinson D, Slabodnick M, Chen A, Goldstein B. MicroPubl Biol. 2018 May 1;2018:10.17912/W2KT0N. doi: 10.17912/W2KT0N. 10.17912/W2KT0N PubMed 32550377