Skip to main content

pFREE
(Plasmid #92050)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92050 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMAZ-SK
  • Total vector size (bp) 7615
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Promoter ptet

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AAAGTCTGGTTATAACC
  • 3′ sequencing primer TACCGGTTTATTGACTACC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    gRNA array
  • Species
    Synthetic
  • Promoter pRhamBAD

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gccacaattcagcaaattgtgaac
  • 3′ sequencing primer GTGCCGATATCTAAGCCTATTGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFREE was a gift from Morten Norholm (Addgene plasmid # 92050 ; http://n2t.net/addgene:92050 ; RRID:Addgene_92050)
  • For your References section:

    A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Lauritsen I, Porse A, Sommer MOA, Norholm MHH. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z. 10.1186/s12934-017-0748-z [pii] PubMed 28764701