-
PurposeAllows inducible expression of gRNAs and Cas9 for plasmid curing.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMAZ-SK
- Total vector size (bp) 7403
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCas9
- Promoter ptet
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AAAGTCTGGTTATAACC
- 3′ sequencing primer TACCGGTTTATTGACTACC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA array
-
SpeciesSynthetic
- Promoter pRhamBAD
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gccacaattcagcaaattgtgaac
- 3′ sequencing primer GTGCCGATATCTAAGCCTATTGAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFREE_Zeo was a gift from Morten Norholm (Addgene plasmid # 92053 ; http://n2t.net/addgene:92053 ; RRID:Addgene_92053) -
For your References section:
A versatile one-step CRISPR-Cas9 based approach to plasmid-curing. Lauritsen I, Porse A, Sommer MOA, Norholm MHH. Microb Cell Fact. 2017 Aug 2;16(1):135. doi: 10.1186/s12934-017-0748-z. 10.1186/s12934-017-0748-z [pii] PubMed 28764701