-
PurposeModified version of lentiMPH v2, a lenti vector encoding the MS2-P65-HSF1 activator helper complex and neo resistance marker (EF1a-MS2-p65-HSF1-2A-Neo-WPRE).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiMPH v2
-
Backbone manufacturerFeng Zhang lab
- Total vector size (bp) 11505
-
Modifications to backboneRemoved T2A-Hygro by digestion with Bsp1407I and EcoRI. Added T2A-Neo by PCR amplification and ligation into these restriction sites.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMS2-P65-HSF1_2A_Neo
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2526
-
MutationN55K in MS2
-
Entrez GeneHSF1 (a.k.a. HSTF1)
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer cacatagcgtaaaaggagcaacatag (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiMPH v2 (Neo) was a gift from Adam Karpf (Addgene plasmid # 92065 ; http://n2t.net/addgene:92065 ; RRID:Addgene_92065) -
For your References section:
Co-regulation and function of FOXM1/RHNO1 bidirectional genes in cancer. Barger CJ, Chee L, Albahrani M, Munoz-Trujillo C, Boghean L, Branick C, Odunsi K, Drapkin R, Zou L, Karpf AR. Elife. 2021 Apr 23;10. pii: 55070. doi: 10.7554/eLife.55070. 10.7554/eLife.55070 PubMed 33890574