shNg pA_RC3J1_CAGW
(Plasmid
#92155)
-
PurposeBicistronic AAV construct encoding GFP control and shRNA targeting Ng
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneunknown
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshRNA targeting Ng
-
Alt nameneurogranin
-
gRNA/shRNA sequenceGATGCCCGTGACAAGACTTCCCTACTGTTTCAAGAGAACAGTAGGGAAGTCTTGTCACTTTTTGGAAA
-
SpeciesH. sapiens (human)
-
Entrez GeneNRGN (a.k.a. RC3, hng)
- Promoter H1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer H1
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shNg pA_RC3J1_CAGW was a gift from Weifeng Xu (Addgene plasmid # 92155 ; http://n2t.net/addgene:92155 ; RRID:Addgene_92155) -
For your References section:
Experience-Dependent Equilibration of AMPAR-Mediated Synaptic Transmission during the Critical Period. Han KS, Cooke SF, Xu W. Cell Rep. 2017 Jan 24;18(4):892-904. doi: 10.1016/j.celrep.2016.12.084. 10.1016/j.celrep.2016.12.084 PubMed 28122240