BtuCD
(Plasmid
#92208)
-
PurposeExpression of BtuCD in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21b+
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5221
- Total vector size (bp) 6946
-
Modifications to backboneAdded entire expression section of pET19b with BtuC gene into original pET21b+. There are 2 expression regions for BtuC and BtuD each with their own T7 Promoter and Terminator
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namebtuC
-
Insert Size (bp)978
-
GenBank ID
-
Entrez GenebtuC (a.k.a. b1711, ECK1709, JW1701)
- Promoter T7 Promoter
-
Tags
/ Fusion Proteins
- 10x Histidine Tag (N terminal on insert)
- Enterokinase Cleavage Site (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer gccgttgagcaccgccgccgcaaggaatgg
- 3′ sequencing primer tactggatgatgggcggtttt AND ctaACGTCCTGCTTTTAACAATAACCAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namebtuD
-
Insert Size (bp)747
-
GenBank ID
-
Entrez GenebtuD (a.k.a. b1709, ECK1707, JW1699)
- Promoter T7 Promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer CTGCCGCAGAGCTGCCTATTG
- 3′ sequencing primer CCGCGCTTAATGCGCCGCTACAGGGCGCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BtuCD was a gift from Douglas Rees (Addgene plasmid # 92208 ; http://n2t.net/addgene:92208 ; RRID:Addgene_92208) -
For your References section:
The E. coli BtuCD structure: a framework for ABC transporter architecture and mechanism. Locher KP, Lee AT, Rees DC. Science. 2002 May 10;296(5570):1091-8. 10.1126/science.1071142 PubMed 12004122