pJExpress414_GmPOPB
(Plasmid
#92234)
-
PurposeExpress wild type prolyl oligopeptidase from Galerina marginata
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92234 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJ414
-
Backbone manufacturerDNA 2.0
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 6229
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProlyl oligopeptidase B from Galerina marginata
-
Alt nameGmPOPB
-
SpeciesGalerina marginata
-
Insert Size (bp)2235
-
Mutationnone
-
GenBank IDJN827314.2
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- 6x-Histag, TEV cleavage site (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TTAATACGACTCACTATAGG
- 3′ sequencing primer AAACCCCTCAAGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDNA 2.0
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJExpress414_GmPOPB was a gift from James Naismith (Addgene plasmid # 92234 ; http://n2t.net/addgene:92234 ; RRID:Addgene_92234) -
For your References section:
Kinetic Landscape of a Peptide Bond-Forming Prolyl Oligopeptidase. Czekster CM, Naismith JH. Biochemistry. 2017 Apr 18;56(15):2086-2095. doi: 10.1021/acs.biochem.7b00012. Epub 2017 Apr 7. 10.1021/acs.biochem.7b00012 PubMed 28332820