Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pZac2.1 GfaABC1D hM3D mCherry SV40
(Plasmid #92284)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92284 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pZac2.1
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hM3D
  • Species
    H. sapiens (human)
  • Entrez Gene
    CHRM3 (a.k.a. EGBRS, HM3, PBS, m3AChR)
  • Promoter GfaABC1D
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer AAGCTTCTTGTACAGCTCGTCCATGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZac2.1 GfaABC1D hM3D mCherry SV40 was a gift from Baljit Khakh (Addgene plasmid # 92284 ; http://n2t.net/addgene:92284 ; RRID:Addgene_92284)
  • For your References section:

    Neural Circuit-Specialized Astrocytes: Transcriptomic, Proteomic, Morphological, and Functional Evidence. Chai H, Diaz-Castro B, Shigetomi E, Monte E, Octeau JC, Yu X, Cohn W, Rajendran PS, Vondriska TM, Whitelegge JP, Coppola G, Khakh BS. Neuron. 2017 Aug 2;95(3):531-549.e9. doi: 10.1016/j.neuron.2017.06.029. Epub 2017 Jul 14. 10.1016/j.neuron.2017.06.029 PubMed 28712653