VE-cad KI gRNA1
(Plasmid
#92310)
-
PurposeCRISPR-GFP-gRNA for cutting VEcad
-
Depositing Lab
-
Depositing OrganizationUniversity of Wisconsin, Madison
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92310 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 92310-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 92310-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneCRISPR-GFP
- Backbone size w/o insert (bp) 9289
- Total vector size (bp) 9292
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVEcad KI gRNA1
-
Alt nameCDH5
-
gRNA/shRNA sequenceTCAGCCAGCATCTTAAACCTG (gRNA shown is without PAM sequence)
-
SpeciesH. sapiens (human)
-
GenBank ID1003
-
Entrez GeneCDH5 (a.k.a. 7B4, CD144)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BBSI (destroyed during cloning)
- 3′ cloning site BBSI (destroyed during cloning)
- 5′ sequencing primer tttcttgggtagtttgcagtttt
- 3′ sequencing primer CGGGTACCTCTAGAGCCATTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 92310-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 92310-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VE-cad KI gRNA1 was a gift from Sean Palecek (Addgene plasmid # 92310 ; http://n2t.net/addgene:92310 ; RRID:Addgene_92310) -
For your References section:
Human pluripotent stem cell-derived epicardial progenitors can differentiate to endocardial-like endothelial cells. Bao X, Bhute VJ, Han T, Qian T, Lian X, Palecek SP. Bioeng Transl Med. 2017 Jun;2(2):191-201. doi: 10.1002/btm2.10062. Epub 2017 May 22. 10.1002/btm2.10062 PubMed 29170757