VE-cad KI gRNA1
(Plasmid
#92310)
-
PurposeCRISPR-GFP-gRNA for cutting VEcad
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92310 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCRISPR-GFP
- Backbone size w/o insert (bp) 9289
- Total vector size (bp) 9292
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVEcad KI gRNA1
-
Alt nameCDH5
-
gRNA/shRNA sequenceTCAGCCAGCATCTTAAACCTG (gRNA shown is without PAM sequence)
-
SpeciesH. sapiens (human)
-
GenBank ID1003
-
Entrez GeneCDH5 (a.k.a. 7B4, CD144)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BBSI (destroyed during cloning)
- 3′ cloning site BBSI (destroyed during cloning)
- 5′ sequencing primer tttcttgggtagtttgcagtttt
- 3′ sequencing primer CGGGTACCTCTAGAGCCATTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VE-cad KI gRNA1 was a gift from Sean Palecek (Addgene plasmid # 92310 ; http://n2t.net/addgene:92310 ; RRID:Addgene_92310) -
For your References section:
Human pluripotent stem cell-derived epicardial progenitors can differentiate to endocardial-like endothelial cells. Bao X, Bhute VJ, Han T, Qian T, Lian X, Palecek SP. Bioeng Transl Med. 2017 Jun;2(2):191-201. doi: 10.1002/btm2.10062. Epub 2017 May 22. 10.1002/btm2.10062 PubMed 29170757