Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBEST-p70a-UTR1-Nterm 6xHis PL-T500
(Plasmid #92314)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92314 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBEST
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 2524
  • Total vector size (bp) 2746
  • Vector type
    Bacterial Expression, Synthetic Biology ; Cell Free Protein Synthesis (CFPS)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    B1 domain of protein L (PL)
  • Species
    Finegoldia Magna
  • Insert Size (bp)
    222
  • GenBank ID
    M86697.1
  • Promoter p70a
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GTGAAGACTATCGCACCATCAG
  • 3′ sequencing primer GATAAAGAAGACAGTCATAAGTGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEST-p70a-UTR1-Nterm 6xHis PL-T500 was a gift from Lital Alfonta (Addgene plasmid # 92314 ; http://n2t.net/addgene:92314 ; RRID:Addgene_92314)
  • For your References section:

    Tuning of Recombinant Protein Expression in Escherichia coli by Manipulating Transcription, Translation Initiation Rates, and Incorporation of Noncanonical Amino Acids. Schlesinger O, Chemla Y, Heltberg M, Ozer E, Marshall R, Noireaux V, Jensen MH, Alfonta L. ACS Synth Biol. 2017 Mar 9. doi: 10.1021/acssynbio.7b00019. 10.1021/acssynbio.7b00019 PubMed 28230975