pBEST-p70a-UTR1-Nterm 6xHis mRFP-T500
(Plasmid
#92316)
-
PurposeExpression of NTerm 6xHis tagged mRFP using the p70a promoter and UTR1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92316 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBEST
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2524
- Total vector size (bp) 3241
-
Vector typeBacterial Expression, Synthetic Biology ; Cell Free Protein Synthesis (CFPS)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOptimized NTerm 6xHis tagged monomeric RFP (mRFP)
-
Alt namemRFP1
-
SpeciesDiscosoma coral
-
Insert Size (bp)717
- Promoter p70a
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTGAAGACTATCGCACCATCAG
- 3′ sequencing primer GATAAAGAAGACAGTCATAAGTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEST-p70a-UTR1-Nterm 6xHis mRFP-T500 was a gift from Lital Alfonta (Addgene plasmid # 92316 ; http://n2t.net/addgene:92316 ; RRID:Addgene_92316) -
For your References section:
Tuning of Recombinant Protein Expression in Escherichia coli by Manipulating Transcription, Translation Initiation Rates, and Incorporation of Noncanonical Amino Acids. Schlesinger O, Chemla Y, Heltberg M, Ozer E, Marshall R, Noireaux V, Jensen MH, Alfonta L. ACS Synth Biol. 2017 Mar 9. doi: 10.1021/acssynbio.7b00019. 10.1021/acssynbio.7b00019 PubMed 28230975