Skip to main content

pBEST-p70a-UTR3-Nterm 6xHis mRFP-T500
(Plasmid #92317)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92317 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBEST
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 2524
  • Total vector size (bp) 3241
  • Vector type
    Bacterial Expression, Synthetic Biology ; Cell Free Protein Synthesis (CFPS)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Optimized NTerm 6xHis tagged monomeric RFP (mRFP)
  • Alt name
    mRFP1
  • Species
    Discosoma coral
  • Insert Size (bp)
    717
  • Promoter p70a
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GTGAAGACTATCGCACCATCAG
  • 3′ sequencing primer GATAAAGAAGACAGTCATAAGTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEST-p70a-UTR3-Nterm 6xHis mRFP-T500 was a gift from Lital Alfonta (Addgene plasmid # 92317 ; http://n2t.net/addgene:92317 ; RRID:Addgene_92317)
  • For your References section:

    Tuning of Recombinant Protein Expression in Escherichia coli by Manipulating Transcription, Translation Initiation Rates, and Incorporation of Noncanonical Amino Acids. Schlesinger O, Chemla Y, Heltberg M, Ozer E, Marshall R, Noireaux V, Jensen MH, Alfonta L. ACS Synth Biol. 2017 Mar 9. doi: 10.1021/acssynbio.7b00019. 10.1021/acssynbio.7b00019 PubMed 28230975