Skip to main content
Addgene

pCAG MCP-VP64
(Plasmid #92357)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92357 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4911
  • Total vector size (bp) 5541
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MCP-VP64
  • Insert Size (bp)
    630
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTGCTGGTTATTGTGCTGT
  • 3′ sequencing primer GTCTCTCACTCGGAAGGACA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    MCP and VP64 fragments amplified from Addgene #61423 and #47319, respectively

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202

Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG MCP-VP64 was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 92357 ; http://n2t.net/addgene:92357 ; RRID:Addgene_92357)
  • For your References section:

    Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Williams RM, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed AA, Sauka-Spengler T. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. 10.1242/dev.160333 PubMed 29386245