pCAG MCP-VP64
(Plasmid
#92357)
-
PurposeCAG-driven ubiquitous expression of MCP-VP64. MCP is bacteriophage MS2 coat protein, VP64 is transcriptional activation domain. Part of SAM-mediated gene activation system in chicken embryos.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92357 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4911
- Total vector size (bp) 5541
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCP-VP64
-
Insert Size (bp)630
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTGCTGGTTATTGTGCTGT
- 3′ sequencing primer GTCTCTCACTCGGAAGGACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMCP and VP64 fragments amplified from Addgene #61423 and #47319, respectively
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202
Please visit https://www.biorxiv.org/content/early/2017/05/08/135525 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG MCP-VP64 was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 92357 ; http://n2t.net/addgene:92357 ; RRID:Addgene_92357) -
For your References section:
Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Williams RM, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed AA, Sauka-Spengler T. Development. 2018 Feb 23;145(4). pii: dev.160333. doi: 10.1242/dev.160333. 10.1242/dev.160333 PubMed 29386245