Skip to main content

Human CRISPR Activation Pooled Library (Calabrese P65-HSF)
(Pooled Libraries #1000000111, #92379, #92379-LV, #92380)

  • Purpose

    The human CRISPR activation library (Calabrese P65-HSF) is in backbone pXPR_502 (P65 HSF). This Calabrese library activates over 18,000 human genes and is used for genome-wide activation screening.

    Each gene activated by this library is targeted by 3–6 gRNAs. These gRNAs are split among the two half-libraries: Set A (Cat# 92379) contains gRNAs 1–3, Set B (Cat# 92380) contains gRNAs 4-6. Each half-library has a unique set of gRNAs, but both are designed to target the same genes. The slight discrepancy in number of genes targeted between Set A and Set B is because not all genes had 6 gRNAs.

    Depositor comments: The modified sgRNA tracr has two MS2 loops and two PP7 loops, although only the PP7 loops are used in this library. This library uses two vectors instead of 3, as the PP7-P65-HSF is on same vector as sgRNA itself. It was found that MS2-P65-HST (hygroR) vector gave poor titer. The 6 guides per gene were designed first based on location relative to TSS, then sequence preferences.

    Primers for the lentiGuide backbone can be used with this library in the Sequencing Protocol.

  • Vector Backbone

    pXPR_502 (Plasmid #96923), which uses P65-HSF to activate a gRNA-scaffold.

Ordering

Item Catalog # Description Quantity Price (USD)
Pooled Library 1000000111 Two tubes, each with a half-library (Set A and B) in backbone XPR_502 (P65 HSF)†
  • #92379 (Set A)
  • #92380 (Set B)
1 $642 Add to Cart
Pooled Library 92379 Set A, one tube, contains Human CRISPRa sgRNA library Calabrese (P65-HSF)† 1 $451 Add to Cart
Lentiviral Prep 92379-LV Limited Stock Available, 1 unit left
Virus (1.15 × 108 TU, titer ≥ 1 × 106 TU/mL)
and Pooled Library DNA More Information
1 $3487 Add to Cart
Lentiviral Prep 92379-LVC Viral service discontinued.
Pooled Library 92380 Set B, one tube, contains Human CRISPRa sgRNA library Calabrese (P65-HSF)† 1 $386 Add to Cart
Available to Academic and Nonprofits Only
† A dCas9 activation plasmid is NOT included with this item and will have to be ordered separately. Can be used in conjunction with lenti dCAS-VP64_Blast (Addgene #61425).

Library Details

  • Species
    Human
  • Genes targeted
    18,885 (Set A), 18,843 (Set B)
  • gRNAs
    56,762 (Set A), 56,476 (Set B)
  • Controls
    500 unique non-targeting controls are in each of the two half-libraries (Set A and Set B)
  • Lentiviral Generation
    3rd

Library Shipping

Each library is delivered in a microcentrifuge tube on blue ice. The tube's contents will not necessarily be frozen. For best results, minimize freeze/thaws.

Pooled libraries #92379 and #92380 will be delivered as a single tube containing a pooled half-library with 3 gRNAs per gene.

Pooled library #1000000111 will be delivered as two tubes, each containing a pooled half-library with 3 gRNAs per gene (for a total of up to 6 unique gRNAs per gene).

  • Volume
    ∼20 µL
  • Concentration
    50 ng/µL

Resource Information

Depositor Comments

Please visit https://doi.org/10.1101/356626 (Link opens in a new window) for bioRxiv preprint.

Information for Lentiviral Prep (Catalog # 92379-LV, Set A) ( Back to top )

Purpose

Ready-to-use lentiviral pooled library for CRISPR activation screening in human cells. Contains 56,762 sgRNAs, targeting 18,885 genes. Lentiviral particles carrying set A of the Calabrese human CRISPRa sgRNA activation library in backbone XPR_502 (P65 HSF) .

Delivery

  • Volume varies depending on titer
  • Titer 1 × 10⁶ TU/mL
  • Storage Store at -80 °C. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Pooled Library DNA (10 µL at 50 ng/µL) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPro SFM
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • ddPCR: 293T cells are transduced with serial dilutions of 92379-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.
PCR confirmation of insert:
  • PCR was carried out with primers targeting the U6 and PGK promoters. The PCR product was visualized on an agarose gel for size confirmation.
    • Forward primer: GAGGGCCTATTTCCCATGATT
    • Reverse Primer: GAACGGACGTGAAGAATGTG

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

Pooled libraries containing at least 1.15 × 108 infectious units are shipped on dry ice at a titer of ≥1 × 106 TU/mL. The total volume is divided among several large aliquots and one 1.3 mL aliquot for testing. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using one aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in a related publication. Before using this virus, Addgene strongly recommends reading this related publication from the same lab (Doench et al., 2016 (Link opens in a new window)).

A brief and partial description of how to use this virus:

  1. Start by optimizing the infection conditions in your cell line in order to achieve 30–50% infection efficiency, corresponding to a multiplicity of infection (MOI) of ~0.5–1. Infect 2.5 × 106 suspension (or 3 × 106 adherent) cells in each well of a 12-well dish at different MOIs. Determine which condition yields a 30–50% infection efficiency, and note the infection efficiency for this condition.

  2. The Calabrese CRISPR activation pooled library (set A) has 56,762 gRNAs. To achieve the recommended representation of ~400 cells per sgRNA, a total of ~2.3 × 107 infected cells is needed. Calculate the number of cells on which to perform the infection by considering the infection efficiency noted in the optimized condition. For example, if the infection efficiency is 50%, perform the infection on 4.5 × 107 cells to ultimately achieve 2.3 × 107 infected cells.

  3. Perform the screening-scale infection with the pre-determined MOI in the same 12-well format as the optimized condition. Briefly, infect 2.5 × 106 suspension (or 3 × 106 adherent) cells in each well of a 12-well dish. Scale up the number of wells to achieve the desired total number of cells.

  4. Based on a screening MOI of 0.5–1 and the total number of cells infected, Addgene estimates that 11–36 mL of virus will be needed to perform the screen. This corresponds to 2.3 × 107-7.6 × 107 TUs. An additional 1 mL of virus will be needed to perform the optimization. Based on the infection efficiency observed in each cell line, these estimates are subject to variation. Not every cell type is infectable under these conditions, and Addgene recommends that infectability of cells be determined empirically.

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

  • This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in a related publication (Doench et al., 2016 (Link opens in a new window)), perform screen analysis by determining the log2-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014 (Link opens in a new window)).

  • The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol for more information.

Information for Concentrated Lentiviral Prep (Catalog # 92379-LVC, Set A) ( Back to top )

Purpose

Ready-to-use lentiviral pooled library for CRISPR activation screening in human cells. Contains 56,762 sgRNAs, targeting 18,885 genes. Concentrated lentiviral particles carrying set A of the Calabrese human CRISPRa sgRNA activation library in backbone XPR_502 (P65 HSF) .

Delivery

  • Volume varies depending on titer
  • Titer 1 × 10⁶ TU/mL
  • Storage Store at -80 °C. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Pooled Library DNA (10 µL at 50 ng/µL) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPro SFM
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • ddPCR: 293T cells are transduced with serial dilutions of 92379-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.
PCR confirmation of insert:
  • PCR was carried out with primers targeting the U6 and PGK promoters. The PCR product was visualized on an agarose gel for size confirmation.
    • Forward primer: GAGGGCCTATTTCCCATGATT
    • Reverse Primer: GAACGGACGTGAAGAATGTG

Visit our viral production page for more information.

Addgene Comments

Shipment specifications:

Pooled libraries containing at least 1.15 × 108 infectious units are shipped on dry ice at a titer of ≥1 × 106 TU/mL. The total volume is divided among several large aliquots and one 1.3 mL aliquot for testing. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

How to use this virus:

We recommend using one aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in a related publication. Before using this virus, Addgene strongly recommends reading this related publication from the same lab (Doench et al., 2016 (Link opens in a new window)).

A brief and partial description of how to use this virus:

  1. Start by optimizing the infection conditions in your cell line in order to achieve 30–50% infection efficiency, corresponding to a multiplicity of infection (MOI) of ~0.5–1. Infect 2.5 × 106 suspension (or 3 × 106 adherent) cells in each well of a 12-well dish at different MOIs. Determine which condition yields a 30–50% infection efficiency, and note the infection efficiency for this condition.

  2. The Calabrese CRISPR activation pooled library (set A) has 56,762 gRNAs. To achieve the recommended representation of ~400 cells per sgRNA, a total of ~2.3 × 107 infected cells is needed. Calculate the number of cells on which to perform the infection by considering the infection efficiency noted in the optimized condition. For example, if the infection efficiency is 50%, perform the infection on 4.5 × 107 cells to ultimately achieve 2.3 × 107 infected cells.

  3. Perform the screening-scale infection with the pre-determined MOI in the same 12-well format as the optimized condition. Briefly, infect 2.5 × 106 suspension (or 3 × 106 adherent) cells in each well of a 12-well dish. Scale up the number of wells to achieve the desired total number of cells.

  4. Based on a screening MOI of 0.5–1 and the total number of cells infected, Addgene estimates that 11–36 mL of virus will be needed to perform the screen. This corresponds to 2.3 × 107-7.6 × 107 TUs. An additional 1 mL of virus will be needed to perform the optimization. Based on the infection efficiency observed in each cell line, these estimates are subject to variation. Not every cell type is infectable under these conditions, and Addgene recommends that infectability of cells be determined empirically.

How to use the virus associated DNA:

Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.

  • This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in a related publication (Doench et al., 2016 (Link opens in a new window)), perform screen analysis by determining the log2-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014 (Link opens in a new window)).

  • The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol for more information.

How to cite this pooled library ( Back to top )

These pooled libraries were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human Calabrese CRISPR Activation Pooled Library (Set A and B) was a gift from David Root and John Doench (Addgene #1000000111)
    Human Calabrese CRISPR Activation Pooled Library Set A was a gift from David Root and John Doench (Addgene #92379 ; http://n2t.net/addgene:92379 ; RRID:Addgene_92379)
    For viral preps, please replace (Addgene #92379) in the above sentence with: (Addgene viral prep # 92379-LV ; http://n2t.net/addgene:92379-LV ; RRID:Addgene_92379-LV)
    Human Calabrese CRISPR Activation Pooled Library Set B was a gift from David Root and John Doench (Addgene #92380 ; http://n2t.net/addgene:92380 ; RRID:Addgene_92380)
  • For your References section:

    Optimized libraries for CRISPR-Cas9 genetic screens with multiple modalities. Sanson KR, Hanna RE, Hegde M, Donovan KF, Strand C, Sullender ME, Vaimberg EW, Goodale A, Root DE, Piccioni F, Doench JG. Nat Commun. 2018 Dec 21;9(1):5416. doi: 10.1038/s41467-018-07901-8. PubMed 30575746