Skip to main content

pWT057a
(Plasmid #96872)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 96872 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFYF1320
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HHR-bsgRNA-EMX1
  • gRNA/shRNA sequence
    GTTCTTCTGCTCGGACTCGGTACATCCAGCTGATGAGTCCCAAATAGGACGAAACGCGCTTCGGTGCGTCCTGGATTCCACGAGTCCGAGCAGAAGAAGAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Unknown

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWT057a was a gift from David Liu (Addgene plasmid # 96872 ; http://n2t.net/addgene:96872 ; RRID:Addgene_96872)
  • For your References section:

    Aptazyme-embedded guide RNAs enable ligand-responsive genome editing and transcriptional activation. Tang W, Hu JH, Liu DR. Nat Commun. 2017 Jun 28;8:15939. doi: 10.1038/ncomms15939. 10.1038/ncomms15939 PubMed 28656978