Skip to main content
Addgene

pINDUCER-21-LCOR
(Plasmid #97038)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97038 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pINDUCER-21
  • Backbone manufacturer
    Stephen Elledge, Thomas Westbrook
  • Backbone size w/o insert (bp) 12152
  • Total vector size (bp) 11683
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ligand Dependent Nuclear Receptor Corepressor
  • Alt name
    LCOR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1218
  • Entrez Gene
    LCOR (a.k.a. C10orf12, MLR2)
  • Promoter Tet on

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCTGGGACGTCGTATGGGTA
  • 3′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pINDUCER-21-LCOR was a gift from George Daley (Addgene plasmid # 97038 ; http://n2t.net/addgene:97038 ; RRID:Addgene_97038)
  • For your References section:

    Haematopoietic stem and progenitor cells from human pluripotent stem cells. Sugimura R, Jha DK, Han A, Soria-Valles C, da Rocha EL, Lu YF, Goettel JA, Serrao E, Rowe RG, Malleshaiah M, Wong I, Sousa P, Zhu TN, Ditadi A, Keller G, Engelman AN, Snapper SB, Doulatov S, Daley GQ. Nature. 2017 May 17. doi: 10.1038/nature22370. 10.1038/nature22370 PubMed 28514439