[UBC][firefly luciferase][target cloning][renilla luciferase]
(Plasmid
#97190)
-
PurposeReporter for translation activation via Pum.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 97190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCI
-
Backbone manufacturerPromega
-
Modifications to backbonemutated to remove BsaI, original promoter replaced with UBC promoter
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFirefly Luciferase
-
Speciesfirefly
-
Insert Size (bp)1686
- Promoter UBC (ubiquitin C)
-
Tag
/ Fusion Protein
- none
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer GTATCTTATCATGTCTGCTCGAAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRenilla Luciferase
-
Speciessea pansy
-
Insert Size (bp)936
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
"Target cloning" is a HindIII-AscI site for inserting recognition sequences for Pum mediated translation activation of the downstream gene. This plasmid corresponds to that shown in Figure 6A.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
[UBC][firefly luciferase][target cloning][renilla luciferase] was a gift from Edward Boyden (Addgene plasmid # 97190 ; http://n2t.net/addgene:97190 ; RRID:Addgene_97190) -
For your References section:
Programmable RNA-binding protein composed of repeats of a single modular unit. Adamala KP, Martin-Alarcon DA, Boyden ES. Proc Natl Acad Sci U S A. 2016 May 10;113(19):E2579-88. doi: 10.1073/pnas.1519368113. Epub 2016 Apr 26. 10.1073/pnas.1519368113 PubMed 27118836