Skip to main content

[UBC][firefly luciferase][target cloning][renilla luciferase]
(Plasmid #97190)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97190 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Modifications to backbone
    mutated to remove BsaI, original promoter replaced with UBC promoter
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Firefly Luciferase
  • Species
    firefly
  • Insert Size (bp)
    1686
  • Promoter UBC (ubiquitin C)
  • Tag / Fusion Protein
    • none

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer GTATCTTATCATGTCTGCTCGAAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Renilla Luciferase
  • Species
    sea pansy
  • Insert Size (bp)
    936

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

"Target cloning" is a HindIII-AscI site for inserting recognition sequences for Pum mediated translation activation of the downstream gene. This plasmid corresponds to that shown in Figure 6A.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    [UBC][firefly luciferase][target cloning][renilla luciferase] was a gift from Edward Boyden (Addgene plasmid # 97190 ; http://n2t.net/addgene:97190 ; RRID:Addgene_97190)
  • For your References section:

    Programmable RNA-binding protein composed of repeats of a single modular unit. Adamala KP, Martin-Alarcon DA, Boyden ES. Proc Natl Acad Sci U S A. 2016 May 10;113(19):E2579-88. doi: 10.1073/pnas.1519368113. Epub 2016 Apr 26. 10.1073/pnas.1519368113 PubMed 27118836