Skip to main content

pGF1-4eCOL2A1
(Plasmid #97210)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97210 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGreenFire1-mCMV (pTRH1 mCMV dscGFP T2A Fluc)
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 8540
  • Total vector size (bp) 8808
  • Modifications to backbone
    Removal of mCMV sequence (139 bp) between SpeI and BamHI sites during subcloning of COL2A1 regulatory elements
  • Vector type
    Mammalian Expression, Lentiviral, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    4 repeats of COL2A1 intronic enhancer (+2126/+2174) upstream of core promoter (-164/+37)
  • Alt name
    COL2A1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    407
  • Entrez Gene
    COL2A1 (a.k.a. ANFH, AOM, COL11A3, SEDC, STL1)
  • Promoter COL2A1 regulatory elements

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGTGAACGGATCTCGACGGTATC
  • 3′ sequencing primer CTTCATCTTGTTGGTCATGCGGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert synthesized by GenScript prior to subcloning into pGreenFire1-mCMV
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This construct can be used for reporting chondrogenic differentiation by transduced stem/progenitor cells.

An NheI site has been placed in between the 4 x enhancer repeats and the core COL2A1 promoter. This will allow those repeats to be removed, if desired (by SpeI and NheI digestion). It will also allow an additional set of repeats to be added (i.e., increasing the total to 8) after NheI digestion of the destination vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGF1-4eCOL2A1 was a gift from Ryan Porter (Addgene plasmid # 97210 ; http://n2t.net/addgene:97210 ; RRID:Addgene_97210)
  • For your References section:

    Specific, sensitive and stable reporting of human mesenchymal stromal cell chondrogenesis. De La Vega RE, Scheu M, Brown LA, Evans C, Ferreira E, Porter RM. Tissue Eng Part C Methods. 2019 Feb 6. doi: 10.1089/ten.TEC.2018.0295. 10.1089/ten.TEC.2018.0295 PubMed 30727864