Skip to main content

pAAVTREGCaMP6f
(Plasmid #97410)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97410 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4477
  • Total vector size (bp) 5830
  • Modifications to backbone
    TRE3 promoter, WPRE
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP6f
  • Species
    R. norvegicus (rat), G. gallus (chicken); Aequorea coerulescens
  • Insert Size (bp)
    1353
  • Promoter TRE3

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTGAACTTGTGGCCGTTTAC
  • 3′ sequencing primer ccttgtataaatcctggttgctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVTREGCaMP6f was a gift from Tetsuo Yamamori (Addgene plasmid # 97410 ; http://n2t.net/addgene:97410 ; RRID:Addgene_97410)
  • For your References section:

    Long-Term Two-Photon Calcium Imaging of Neuronal Populations with Subcellular Resolution in Adult Non-human Primates. Sadakane O, Masamizu Y, Watakabe A, Terada S, Ohtsuka M, Takaji M, Mizukami H, Ozawa K, Kawasaki H, Matsuzaki M, Yamamori T. Cell Rep. 2015 Dec 1;13(9):1989-99. doi: 10.1016/j.celrep.2015.10.050. Epub 2015 Nov 19. 10.1016/j.celrep.2015.10.050 PubMed 26655910