AAV2_hSyn_iChloC_CA_Citrine
(Plasmid
#98220)
-
PurposeSlow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with blue to green light, inactivation max with 605 nm (accelarates closure to ms). Codon optimized for mammalian expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98220 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV2
- Backbone size w/o insert (bp) 5303
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynthetic construct iChloC_C128A gene
-
Alt nameiChloC
-
Alt nameCrChR2
-
SpeciesSynthetic; Chlamydomonas reinhardtii
-
Insert Size (bp)927
-
MutationE83Q, E90R, E101S, C128A, T159C, D156N
- Promoter human synapsin
-
Tag
/ Fusion Protein
- Citrine (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer TGAACAGCTCCTCGCCCTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2017/06/27/156422 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV2_hSyn_iChloC_CA_Citrine was a gift from Simon Wiegert (Addgene plasmid # 98220 ; http://n2t.net/addgene:98220 ; RRID:Addgene_98220) -
For your References section:
Anion-conducting channelrhodopsins with tuned spectra and modified kinetics engineered for optogenetic manipulation of behavior. Wietek J, Rodriguez-Rozada S, Tutas J, Tenedini F, Grimm C, Oertner TG, Soba P, Hegemann P, Wiegert JS. Sci Rep. 2017 Nov 2;7(1):14957. doi: 10.1038/s41598-017-14330-y. 10.1038/s41598-017-14330-y PubMed 29097684