-
PurposeLentiviral expression of MED12
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLX307
-
Backbone manufacturerDavid Root (Addgene plasmid # 41392)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMED12
-
SpeciesH. sapiens (human)
-
MutationR1392Q
-
Entrez GeneMED12 (a.k.a. ARC240, CAGH45, FGS1, HDKR, HOPA, Kto, MED12S, OHDOX, OKS, OPA1, TNRC11, TRAP230)
- Promoter E1Fa
-
Tag
/ Fusion Protein
- V5 (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTCTTCCATTTCAGGTGTCGTGAG
- 3′ sequencing primer GTGGATACGCTGCTTTAATGCCTT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's sequencing results found an R1392Q mutation compared to reference sequence NP_005111.2. This change is not known to affect MED12 function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MED12_pLX307 was a gift from William Hahn & Sefi Rosenbluh (Addgene plasmid # 98350 ; http://n2t.net/addgene:98350 ; RRID:Addgene_98350) -
For your References section:
Genetic and Proteomic Interrogation of Lower Confidence Candidate Genes Reveals Signaling Networks in beta-Catenin-Active Cancers. Rosenbluh J, Mercer J, Shrestha Y, Oliver R, Tamayo P, Doench JG, Tirosh I, Piccioni F, Hartenian E, Horn H, Fagbami L, Root DE, Jaffe J, Lage K, Boehm JS, Hahn WC. Cell Syst. 2016 Sep 28;3(3):302-316.e4. doi: 10.1016/j.cels.2016.09.001. 10.1016/j.cels.2016.09.001 PubMed 27684187