pYZ164
(Plasmid
#98408)
-
PurposeCas9-gRNA his3 plasmid for his3 deletion in S. pombe
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYZ033
- Backbone size w/o insert (bp) 11350
- Total vector size (bp) 11370
-
Vector typeCRISPR
-
Selectable markersSpura4
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting Sp.his3
-
gRNA/shRNA sequenceSp.his3 atttattggatataatgaca
-
SpeciesS. pombe (fission yeast)
-
Entrez Genehis3 (a.k.a. SPBC11B10.02c)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer M13F
- 3′ sequencing primer M13R
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYZ164 was a gift from Jef Boeke (Addgene plasmid # 98408 ; http://n2t.net/addgene:98408 ; RRID:Addgene_98408) -
For your References section:
Construction of Designer Selectable Marker Deletions with CRISPR-Cas9 Toolbox in Schizosaccharomyces pombe and Optimized Design of Common Entry Vectors. Zhao Y, Boeke JD. G3 (Bethesda). 2018 Jan 10. pii: g3.117.300363. doi: 10.1534/g3.117.300363. 10.1534/g3.117.300363 PubMed 29321167