pluc2-iRFP720
(Plasmid
#98887)
-
PurposeMammalian expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTurbo
-
Backbone manufacturerEvrogen
- Total vector size (bp) 6565
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFirefly Luciferase
-
Alt nameLuc2
-
SpeciesPhotinus Pyralis
-
Insert Size (bp)1641
- Promoter CMV
-
Tag
/ Fusion Protein
- iRFP720 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer gctagcaatggaagatgccaaaaac
- 3′ sequencing primer gtcgactgcttgccgcccttcttggcct
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pluc2-iRFP720 was a gift from Laura Mezzanotte (Addgene plasmid # 98887 ; http://n2t.net/addgene:98887 ; RRID:Addgene_98887) -
For your References section:
Optimized longitudinal monitoring of stem cell grafts in mouse brain using a novel bioluminescent/near infrared fluorescent fusion reporter. Mezzanotte L, Iljas JD, Que I, Chan A, Kaijzel E, Hoeben R, Lowik C. Cell Transplant. 2017 Apr 26. doi: 10.3727/096368917X695407. 10.3727/096368917X695407 PubMed 28447574