pRM006
(Plasmid
#98922)
-
PurposeExpress Histag-SUMO-FtsZ for purification in E coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 98922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTB146
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFtsZ
-
SpeciesE. coli
-
Insert Size (bp)1764
- Promoter T7
-
Tag
/ Fusion Protein
- Histag-SUMO (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTTGTTTAACTTTAAGAAGGAG
- 3′ sequencing primer AACTCAGCTTCCTTTCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRM006 was a gift from Jie Xiao (Addgene plasmid # 98922 ; http://n2t.net/addgene:98922 ; RRID:Addgene_98922) -
For your References section:
GTPase activity-coupled treadmilling of the bacterial tubulin FtsZ organizes septal cell wall synthesis. Yang X, Lyu Z, Miguel A, McQuillen R, Huang KC, Xiao J. Science. 2017 Feb 17;355(6326):744-747. doi: 10.1126/science.aak9995. 10.1126/science.aak9995 PubMed 28209899