-
PurposeExpress human Insulin Degrading Enzyme (IDE) in E. coli.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99014 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepProEx
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 7800
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameinsulin degrading enzyme
-
Alt nameIDE
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2973
-
Entrez GeneIDE (a.k.a. INSULYSIN)
- Promoter TRC
-
Tag
/ Fusion Protein
- His tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI, HindIII, KpnI (unknown if destroyed)
- 5′ sequencing primer ggtccgtataatctgtggaattgtgagcggataac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pProEx-IDE-wt was a gift from Wei-Jen Tang (Addgene plasmid # 99014 ; http://n2t.net/addgene:99014 ; RRID:Addgene_99014) -
For your References section:
Structures of human insulin-degrading enzyme reveal a new substrate recognition mechanism. Shen Y, Joachimiak A, Rosner MR, Tang WJ. Nature. 2006 Oct 19;443(7113):870-4. Epub 2006 Oct 11. 10.1038/nature05143 PubMed 17051221