Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pProEx-IDE-wt
(Plasmid #99014)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99014 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pProEx
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 7800
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    insulin degrading enzyme
  • Alt name
    IDE
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2973
  • Entrez Gene
    IDE (a.k.a. INSULYSIN)
  • Promoter TRC
  • Tag / Fusion Protein
    • His tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI, HindIII, KpnI (unknown if destroyed)
  • 5′ sequencing primer ggtccgtataatctgtggaattgtgagcggataac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pProEx-IDE-wt was a gift from Wei-Jen Tang (Addgene plasmid # 99014 ; http://n2t.net/addgene:99014 ; RRID:Addgene_99014)
  • For your References section:

    Structures of human insulin-degrading enzyme reveal a new substrate recognition mechanism. Shen Y, Joachimiak A, Rosner MR, Tang WJ. Nature. 2006 Oct 19;443(7113):870-4. Epub 2006 Oct 11. 10.1038/nature05143 PubMed 17051221