pMVS142_pACT1_mCherry_Zif268_EBD_MCS_KAN
(Plasmid
#99049)
-
PurposeTranscription Factor chassis for activation domains. mCherry, Zif268 DNA binding domain, estrogen response domain
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99049 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFA6
- Backbone size w/o insert (bp) 4149
- Total vector size (bp) 7042
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameACT1 promoter
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)988
-
Entrez GeneACT1 (a.k.a. YFL039C, ABY1, END7)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer SP6
- 3′ sequencing primer CCTTGGTCACCTTCAGCTTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)705
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer Sp6
- 3′ sequencing primer CTGTATGGATTTTGGTATGC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameZif268 DNA binding Domain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)261
-
GenBank ID1AAY_A COG5048
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGCCATCATCAAGGAGTT
- 3′ sequencing primer CAGGAGTGATGAACGCAAGA
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameEstrogen response domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)885
-
Entrez GeneESR1 (a.k.a. ER, ESR, ESRA, ESTRR, Era, NR3A1)
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer TACCCGCCCATATGCTTG
- 3′ sequencing primer tgaagtagagcccgcagt
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMVS142_pACT1_mCherry_Zif268_EBD_MCS_KAN was a gift from Barak Cohen (Addgene plasmid # 99049 ; http://n2t.net/addgene:99049 ; RRID:Addgene_99049) -
For your References section:
A High-Throughput Mutational Scan of an Intrinsically Disordered Acidic Transcriptional Activation Domain. Staller MV, Holehouse AS, Swain-Lenz D, Das RK, Pappu RV, Cohen BA. Cell Syst. 2018 Mar 1. pii: S2405-4712(18)30052-8. doi: 10.1016/j.cels.2018.01.015. 10.1016/j.cels.2018.01.015 PubMed 29525204