pT7TS-rich
(Plasmid
#99050)
-
Purpose(Empty Backbone) This plasmid is useful for in vitro transcription of genes using T7 promoter. Can be used for Xenopus oocyte assay. It is derived from pT7TS. More sites for cloning are incorporated.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99050 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT7TS-rich ( based on pT7TS)
- Backbone size (bp) 3025
-
Vector typeUnspecified ; Xenopus oocyte system
- Promoter pT7
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCTCTAATACGACTCACTATAGG
- 3′ sequencing primer TTAGGAGCAGATACGAATGG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byWe modified plasmid pT7TS (Krieg Lab Plasmid) originally received from the Addgene. Earlier it only had three sites for cloning. Now we included more sites that are compatible for double digestion.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: This plasmid can exist as a dimer. This is not expected to impact the end function of the plasmid. Please refer to the Addgene Blog post on multimers for more information: https://blog.addgene.org/plasmids-101-dimers-and-multimers
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7TS-rich was a gift from Richard Bélanger (Addgene plasmid # 99050 ; http://n2t.net/addgene:99050 ; RRID:Addgene_99050)