Skip to main content

pT7TS-rich
(Plasmid #99050)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99050 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pT7TS-rich ( based on pT7TS)
  • Backbone size (bp) 3025
  • Vector type
    Unspecified ; Xenopus oocyte system
  • Promoter pT7

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GCTCTAATACGACTCACTATAGG
  • 3′ sequencing primer TTAGGAGCAGATACGAATGG
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    We modified plasmid pT7TS (Krieg Lab Plasmid) originally received from the Addgene. Earlier it only had three sites for cloning. Now we included more sites that are compatible for double digestion.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: This plasmid can exist as a dimer. This is not expected to impact the end function of the plasmid. Please refer to the Addgene Blog post on multimers for more information: https://blog.addgene.org/plasmids-101-dimers-and-multimers

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7TS-rich was a gift from Richard Bélanger (Addgene plasmid # 99050 ; http://n2t.net/addgene:99050 ; RRID:Addgene_99050)