-
PurposeEmpty gRNA scaffold with "Flip" and "Extension" modifications with optimized chicken specific U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99139 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCESAx
- Total vector size (bp) 3018
-
Modifications to backboneMutated BsaI sites for protospacer cloning
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegRNA
-
gRNA/shRNA sequenceEmpty
- Promoter chicken U6.3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cctataaaaataggcgtatcacg
- 3′ sequencing primer tggcctgcccggttattattatt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6.3>gRNA.f+e was a gift from Marianne Bronner (Addgene plasmid # 99139 ; http://n2t.net/addgene:99139 ; RRID:Addgene_99139) -
For your References section:
Optimization of CRISPR/Cas9 genome editing for loss-of-function in the early chick embryo. Gandhi S, Piacentino ML, Vieceli FM, Bronner ME. Dev Biol. 2017 Dec 1;432(1):86-97. doi: 10.1016/j.ydbio.2017.08.036. 10.1016/j.ydbio.2017.08.036 PubMed 29150011