Skip to main content
Addgene

pUB6-CDC34-HA (pRKB261)
(Plasmid #99145)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99145 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUB6/V5-His A
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 5500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CDC34
  • Alt name
    cell division cycle 34
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • GenBank ID
    NM_004359.1 NP_004350.1
  • Entrez Gene
    CDC34 (a.k.a. E2-CDC34, UBC3, UBCH3, UBE2R1)
  • Promoter pTight
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer TCAGTGTTAGACTAGTAAATTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A CDC34 sequence-verified cDNA clone was ordered from Dharmacon (clone ID 4103120). The CDC34 cDNA was cut out with restriction enzymes EcoRI/XhoI (NEB) and cloned into the mammalian expression vector pUB6/V5-His A (Thermo Fisher Scientific) via ligation. A C-terminal HA-tag was introduced via PCR primer overhangs to generate the pUB6-CDC34-HA construct for transfection.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUB6-CDC34-HA (pRKB261) was a gift from Robert Bradley (Addgene plasmid # 99145 ; http://n2t.net/addgene:99145 ; RRID:Addgene_99145)
  • For your References section:

    The RNA Surveillance Factor UPF1 Represses Myogenesis via Its E3 Ubiquitin Ligase Activity. Feng Q, Jagannathan S, Bradley RK. Mol Cell. 2017 Jul 20;67(2):239-251.e6. doi: 10.1016/j.molcel.2017.05.034. Epub 2017 Jun 29. 10.1016/j.molcel.2017.05.034 PubMed 28669802