Skip to main content
Addgene

pLXIN2-RFP
(Plasmid #99205)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99205 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLXIN2
  • Backbone manufacturer
    Mathupala, S.P.
  • Backbone size w/o insert (bp) 6059
  • Total vector size (bp) 6780
  • Modifications to backbone
    EGFP (enhanced green fluorecent protein) cDNA was inserted between EcoRI and XhoI sites of the MCS in vector.
  • Vector type
    Mammalian Expression, Retroviral ; Bicistronic retroviral expression vector
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can be grown in DH5alpha. However, to minimize recombination events, E. coli SURE or STBL is recommended.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Red fluorescent protein
  • Alt name
    RFP
  • Species
    Synthetic; Discosoma sp.
  • Insert Size (bp)
    682
  • Mutation
    The dsRed cDNA was PCR amplified off AddGene plasmid pCAG-DsRed (#11151)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GTGCAATCCATCTTGTTCAATGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

When transfected into amphotropic (PA317) or ecotropic (PE501) mammalian packaging cell lines, the plasmid pLXIN2 will generate live retrovirus. Thus, the procedures will require handling at BSL2 level, when the plasmid is used to generate recombinant retrovirus for transduction.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLXIN2-RFP was a gift from Saroj Mathupala (Addgene plasmid # 99205 ; http://n2t.net/addgene:99205 ; RRID:Addgene_99205)