pLXIN2-RFP
(Plasmid #99205)

• Purpose: RFP expressing bicistronic retroviral vector
• Depositing Lab: Saroj Mathupala
• Publication: pLXIN2 (unpublished)

Backbone

• Vector backbone: pLXIN2
• Backbone manufacturer: Mathupala, S.P.
• Backbone size w/o insert (bp): 6059
• Total vector size (bp): 6780
• Modifications to backbone: EGFP (enhanced green fluorecent protein) cDNA was inserted between EcoRI and XhoI sites of the MCS in vector.
• Vector type: Mammalian Expression, Retroviral ; Bicistronic retroviral expression vector
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can be grown in DH5alpha. However, to minimize recombination events, E. coli SURE or STBL is recommended.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Red fluorescent protein
• Alt name: RFP
• Species: Synthetic; Discosoma sp.
• Insert Size (bp): 682
• Mutation: The dsRed cDNA was PCR amplified off AddGene plasmid pCAG-DsRed (#11151)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: GTGCAATCCATCTTGTTCAATGGC

Resource Information

• Supplemental Documents:
  • Microscopy images

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When transfected into amphotropic (PA317) or ecotropic (PE501) mammalian packaging cell lines, the plasmid pLXIN2 will generate live retrovirus. Thus, the procedures will require handling at BSL2 level, when the plasmid is used to generate recombinant retrovirus for transduction.