pCMV-Lifect-7-pr-mEos2 (mEos2-A69T)
(Plasmid
#99229)
-
PurposeMammalian expression of the primed conversion capable protein pr-mEos2 (mEos2-A69T) as a Lifeact fusion.
-
Depositing Lab
-
Depositing OrganizationETH Zurich (Swiss Federal Institute of Technology)
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99229 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 99229-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 99229-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4012
- Total vector size (bp) 4793
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepr-mEos2
-
Alt nameprmEos2, mEos2-A69T
-
SpeciesSynthetic
-
Insert Size (bp)681
-
MutationA69T for primed conversion applications
- Promoter CMV
-
Tag
/ Fusion Protein
- Lifeact (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 99229-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 99229-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-Lifect-7-pr-mEos2 (mEos2-A69T) was a gift from Periklis Pantazis (Addgene plasmid # 99229 ; http://n2t.net/addgene:99229 ; RRID:Addgene_99229) -
For your References section:
Rational Engineering of Photoconvertible Fluorescent Proteins for Dual-Color Fluorescence Nanoscopy Enabled by a Triplet-State Mechanism of Primed Conversion. Mohr MA, Kobitski AY, Sabater LR, Nienhaus K, Obara CJ, Lippincott-Schwartz J, Nienhaus GU, Pantazis P. Angew Chem Int Ed Engl. 2017 Jun 29. doi: 10.1002/anie.201706121. 10.1002/anie.201706121 PubMed 28661566