pCMV-Lifect-7-pr-mEos2 (mEos2-A69T)
(Plasmid
#99229)
-
PurposeMammalian expression of the primed conversion capable protein pr-mEos2 (mEos2-A69T) as a Lifeact fusion.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99229 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4012
- Total vector size (bp) 4793
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepr-mEos2
-
Alt nameprmEos2, mEos2-A69T
-
SpeciesSynthetic
-
Insert Size (bp)681
-
MutationA69T for primed conversion applications
- Promoter CMV
-
Tag
/ Fusion Protein
- Lifeact (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-Lifect-7-pr-mEos2 (mEos2-A69T) was a gift from Periklis Pantazis (Addgene plasmid # 99229 ; http://n2t.net/addgene:99229 ; RRID:Addgene_99229) -
For your References section:
Rational Engineering of Photoconvertible Fluorescent Proteins for Dual-Color Fluorescence Nanoscopy Enabled by a Triplet-State Mechanism of Primed Conversion. Mohr MA, Kobitski AY, Sabater LR, Nienhaus K, Obara CJ, Lippincott-Schwartz J, Nienhaus GU, Pantazis P. Angew Chem Int Ed Engl. 2017 Jun 29. doi: 10.1002/anie.201706121. 10.1002/anie.201706121 PubMed 28661566