pVAX1/mTyr-Cre
(Plasmid
#99249)
-
PurposeExpresses Cre recombinase under tyrosinase promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepVAX1
-
Backbone manufacturerLife Technologies
- Total vector size (bp) 3945
-
Modifications to backboneno CMV, added mTyr enh/prom and Cre
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCre recombinase
-
Insert Size (bp)1085
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer GATGTACGGGCCAGATATACGCG
- 3′ sequencing primer AGTGGGAGTGGCACCTTCCAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemTyr enh/prom
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)560
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GATGTACGGGCCAGATATACGCG
- 3′ sequencing primer AGTGGGAGTGGCACCTTCCAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFor 1 gene in the plasmid (Cre), it originally came from a plasmid originating from Addgene (Connie Cepko)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVAX1/mTyr-Cre was a gift from Christian Blank (Addgene plasmid # 99249 ; http://n2t.net/addgene:99249 ; RRID:Addgene_99249) -
For your References section:
Dermal Delivery of Constructs Encoding Cre Recombinase to Induce Skin Tumors in PtenLoxP/LoxP;BrafCA/+ Mice. Deken MA, Song JY, Gadiot J, Bins AD, Kroon P, Verbrugge I, Blank CU. Int J Mol Sci. 2016 Dec 20;17(12). pii: E2149. doi: 10.3390/ijms17122149. 10.3390/ijms17122149 PubMed 27999416