pVAX1/mTyr-Cre
(Plasmid #99249)

• Purpose: Expresses Cre recombinase under tyrosinase promoter
• Depositing Lab: Christian Blank
• Publication: Deken et al Int J Mol Sci. 2016 Dec 20;17(12). pii: E2149. doi: 10.3390/ijms17122149.

Backbone

• Vector backbone: pVAX1
• Backbone manufacturer: Life Technologies
• Total vector size (bp): 3945
• Modifications to backbone: no CMV, added mTyr enh/prom and Cre
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cre recombinase
• Insert Size (bp): 1085
• Tag / Fusion Protein:
  • Myc (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: ApaI (not destroyed)
• 5′ sequencing primer: GATGTACGGGCCAGATATACGCG
• 3′ sequencing primer: AGTGGGAGTGGCACCTTCCAG

Gene/Insert 2

• Gene/Insert name: mTyr enh/prom
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 560

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GATGTACGGGCCAGATATACGCG
• 3′ sequencing primer: AGTGGGAGTGGCACCTTCCAG

Resource Information

• Supplemental Documents:
  • pVAX1_mTyr-Cre.gb
• A portion of this plasmid was derived from a plasmid made by: For 1 gene in the plasmid (Cre), it originally came from a plasmid originating from Addgene (Connie Cepko)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry