pGLACTE-HT51-10
(Plasmid
#99255)
-
PurposeContains expanded CGG repeats (98 repeats with 2 AGG interruptions) within the 5'UTR of FMR1. To generate capillary electrophoresis size standards.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3
- Total vector size (bp) 4945
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFMR1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)554
-
Entrez GeneFMR1 (a.k.a. FMRP, FRAXA, POF, POF1)
-
Tag
/ Fusion Protein
- eGFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATAAGCTTTAGGCGTGTACGG
- 3′ sequencing primer cgctgaacttgtggccgttta
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The CGG repeats are moderately unstable in prolonged bacterial culture at 37C.
Upon receipt select several colonies, grow up overnight and immediately use to make glycerol stocks and verify insert size.
For large scale preparations inoculate directly from the glycerol stock and culture for ~10 hours.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGLACTE-HT51-10 was a gift from Karen Usdin (Addgene plasmid # 99255 ; http://n2t.net/addgene:99255 ; RRID:Addgene_99255) -
For your References section:
Improved Assays for AGG Interruptions in Fragile X Premutation Carriers. Hayward BE, Usdin K. J Mol Diagn. 2017 Nov;19(6):828-835. doi: 10.1016/j.jmoldx.2017.06.008. Epub 2017 Aug 14. 10.1016/j.jmoldx.2017.06.008 PubMed 28818679