Skip to main content

pGLACTE-HT51-10
(Plasmid #99255)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99255 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3
  • Total vector size (bp) 4945

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FMR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    554
  • Entrez Gene
    FMR1 (a.k.a. FMRP, FRAXA, POF, POF1)
  • Tag / Fusion Protein
    • eGFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATAAGCTTTAGGCGTGTACGG
  • 3′ sequencing primer cgctgaacttgtggccgttta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The CGG repeats are moderately unstable in prolonged bacterial culture at 37C.
Upon receipt select several colonies, grow up overnight and immediately use to make glycerol stocks and verify insert size.
For large scale preparations inoculate directly from the glycerol stock and culture for ~10 hours.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGLACTE-HT51-10 was a gift from Karen Usdin (Addgene plasmid # 99255 ; http://n2t.net/addgene:99255 ; RRID:Addgene_99255)
  • For your References section:

    Improved Assays for AGG Interruptions in Fragile X Premutation Carriers. Hayward BE, Usdin K. J Mol Diagn. 2017 Nov;19(6):828-835. doi: 10.1016/j.jmoldx.2017.06.008. Epub 2017 Aug 14. 10.1016/j.jmoldx.2017.06.008 PubMed 28818679