Skip to main content

pCS2+ H2B-mCherry
(Plasmid #99265)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99265 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2+
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    708
  • Promoter SP6
  • Tag / Fusion Protein
    • H2B (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site Xbal (not destroyed)
  • 5′ sequencing primer CGATTTAGGTGACACTATAG
  • 3′ sequencing primer TAATACGACTCACTATAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+ H2B-mCherry was a gift from Philipp Keller (Addgene plasmid # 99265 ; http://n2t.net/addgene:99265 ; RRID:Addgene_99265)
  • For your References section:

    Single-Cell Reconstruction of Emerging Population Activity in an Entire Developing Circuit. Wan Y, Wei Z, Looger LL, Koyama M, Druckmann S, Keller PJ. Cell. 2019 Oct 3;179(2):355-372.e23. doi: 10.1016/j.cell.2019.08.039. Epub 2019 Sep 26. 10.1016/j.cell.2019.08.039 PubMed 31564455