pCS2+ H2B-mRuby2
(Plasmid
#99270)
-
PurposeContains a fusion of human histone H2B to fluorescent protein mRuby2 in the pCS2+ expression vector. It has the SP6 RNA polymerase site for in vitro transcription.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemRuby2-3XHA
-
Insert Size (bp)1095
- Promoter SP6
-
Tag
/ Fusion Protein
- H2B (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGATTTAGGTGACACTATAG
- 3′ sequencing primer TAATACGACTCACTATAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+ H2B-mRuby2 was a gift from Philipp Keller (Addgene plasmid # 99270 ; http://n2t.net/addgene:99270 ; RRID:Addgene_99270)