-
Purpose(Empty Backbone) Expression of immunoglobulin light chains in mammalian cells, human lambda 2 constant region
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99575 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size (bp) 4976
-
Vector typeMammalian Expression
- Promoter hCMV IE1 gene promoter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCTTCGTTAGAACGCGGCTAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AbVec1.1-IGLC2-XhoI was a gift from Hedda Wardemann (Addgene plasmid # 99575 ; http://n2t.net/addgene:99575 ; RRID:Addgene_99575) -
For your References section:
Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. Tiller T, Meffre E, Yurasov S, Tsuiji M, Nussenzweig MC, Wardemann H. J Immunol Methods. 2008 Jan 1;329(1-2):112-24. Epub 2007 Oct 31. 10.1016/j.jim.2007.09.017 PubMed 17996249