pAAV-CMV-dSa VP64 Hbb
(Plasmid
#99693)
-
PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAV
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99693 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV (pUC f1)
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC)
-
SpeciesM. musculus (mouse), Synthetic
-
Mutationdead Cas9
-
Entrez GeneHbb
-
Tag
/ Fusion Protein
- VP64 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-dSa VP64 Hbb was a gift from George Church (Addgene plasmid # 99693 ; http://n2t.net/addgene:99693 ; RRID:Addgene_99693) -
For your References section:
Rational design of a compact CRISPR-Cas9 activator for AAV-mediated delivery. Vora S, Cheng J, Xiao R, VanDusen NJ, Quintino L, Pu WT, Vandenberghe LH, Chavez A, Church G. bioRxiv 2018. 298620 10.1101/298620