-
Purpose3rd generation lentiviral vector expresses shRNA against human Stx3S with a GFP reporter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGreenPuro
-
Backbone manufacturerSystem Biosciences Inc.
- Backbone size w/o insert (bp) 7861
- Total vector size (bp) 7882
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin ; CopGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshRNA against Stx3S
-
gRNA/shRNA sequenceggaagaaactgatttcactcc
-
SpeciesH. sapiens (human)
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AATGTCTTTGGATTTGGGAATCTTAT
- 3′ sequencing primer TGGTCTAACCAGAGAGACCCAGTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGreenPuro-shRNA-Stx3S-C4 was a gift from Thomas Weimbs (Addgene plasmid # 99742 ; http://n2t.net/addgene:99742 ; RRID:Addgene_99742) -
For your References section:
Soluble syntaxin 3 functions as a transcriptional regulator. Giovannone AJ, Winterstein C, Bhattaram P, Reales E, Low SH, Baggs JE, Xu M, Lalli MA, Hogenesch JB, Weimbs T. J Biol Chem. 2018 Apr 13;293(15):5478-5491. doi: 10.1074/jbc.RA117.000874. Epub 2018 Feb 23. 10.1074/jbc.RA117.000874 PubMed 29475951