Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA4 h-Stx3 resistant to shRNA #304-2xMyc/His
(Plasmid #99746)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99746 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA4
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 5075
  • Total vector size (bp) 5909
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Stx3
  • Alt name
    Stx3A
  • Alt name
    Stx3 isoform 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    834
  • Mutation
    Made six (6) silent mutations to confer resistance to shRNA #304.
  • GenBank ID
    NM_004177.4
  • Entrez Gene
    STX3 (a.k.a. DIAR12, MVID2, RDMVID, STX3A)
  • Promoter CMV/TO
  • Tag / Fusion Protein
    • myc-myc-his (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer acgcaaatgggcggtaggcgtg
  • 3′ sequencing primer tagaaggcacagtcgaggctg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA4 h-Stx3 resistant to shRNA #304-2xMyc/His was a gift from Thomas Weimbs (Addgene plasmid # 99746 ; http://n2t.net/addgene:99746 ; RRID:Addgene_99746)
  • For your References section:

    Monoubiquitination of syntaxin 3 leads to retrieval from the basolateral plasma membrane and facilitates cargo recruitment to exosomes. Giovannone AJ, Reales E, Bhattaram P, Fraile-Ramos A, Weimbs T. Mol Biol Cell. 2017 Oct 15;28(21):2843-2853. doi: 10.1091/mbc.E17-07-0461. Epub 2017 Aug 16. 10.1091/mbc.E17-07-0461 PubMed 28814500