-
Purposemammalian expression with secretive signal and avi tag for biotinylation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99847 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG.I-SceI
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameephrin b2
-
SpeciesH. sapiens (human)
-
Entrez GeneEPHB2 (a.k.a. BDPLT22, CAPB, DRT, EK5, EPHT3, ERK, Hek5, PCBC, Tyro5)
-
Tag
/ Fusion Protein
- Avi (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CTCTAGAGCCTCTGCTAAC
- 3′ sequencing primer CTCGAGTGATCATTAGTGAT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHL-avitag3 was a gift from Edith Yvonne Jones (Addgene plasmid # 99847 ; http://n2t.net/addgene:99847 ; RRID:Addgene_99847) -
For your References section:
A time- and cost-efficient system for high-level protein production in mammalian cells. Aricescu AR, Lu W, Jones EY. Acta Crystallogr D Biol Crystallogr. 2006 Oct;62(Pt 10):1243-50. Epub 2006 Sep 19. 10.1107/S0907444906029799 PubMed 17001101