Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHL-avitag3
(Plasmid #99847)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 99847 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ephrin b2
  • Species
    H. sapiens (human)
  • Entrez Gene
    EPHB2 (a.k.a. BDPLT22, CAPB, DRT, EK5, EPHT3, ERK, Hek5, PCBC, Tyro5)
  • Tag / Fusion Protein
    • Avi (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAAC
  • 3′ sequencing primer CTCGAGTGATCATTAGTGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHL-avitag3 was a gift from Edith Yvonne Jones (Addgene plasmid # 99847 ; http://n2t.net/addgene:99847 ; RRID:Addgene_99847)
  • For your References section:

    A time- and cost-efficient system for high-level protein production in mammalian cells. Aricescu AR, Lu W, Jones EY. Acta Crystallogr D Biol Crystallogr. 2006 Oct;62(Pt 10):1243-50. Epub 2006 Sep 19. 10.1107/S0907444906029799 PubMed 17001101