Skip to main content

Nonsense-mediated mRNA decay uses complementary mechanisms to suppress mRNA and protein accumulation.

Udy DB, Bradley RK
Life Sci Alliance. 2021 Dec 8;5(3). pii: 5/3/e202101217. doi: 10.26508/lsa.202101217. Print 2022 Mar. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
184393pCMV-3XFLAG-renilla-luciferase-beta-globin-controlTransient transfection plasmid expressing Renilla-luciferase-beta-globin fusion protein
184394pCMV-3XFLAG-renilla-luciferase-beta-globin-(39PTC)Transient transfection plasmid expressing Renilla-luciferase-beta-globin fusion protein with PTC in beta-globin
184395AAVS1-TetOn-3XFLAG-firefly-beta-globin-control-AAVS1Donor plasmid for stable integration of firefly luciferase control reporter at AAVS1
184396AAVS1-TetOn-3XFLAG-renilla-beta-globin-control-AAVS1Donor plasmid for stable integration of Renilla luciferase control reporter at AAVS1
184397AAVS1-TetOn-3XFLAG-firefly-beta-globin-PTC39-AAVS1Donor plasmid for stable integration of firefly luciferase NMD(+) PTC39 reporter at AAVS1
184398AAVS1-TetOn-3XFLAG-renilla-beta-globin-PTC39-AAVS1Donor plasmid for stable integration of Renilla luciferase NMD(+) PTC39 reporter at AAVS1
184403pX459-sgAAVS1pX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGAT

Antibodies from Article